현재 위치
  1. 게시판
  2. 이너뷰티정보

이너뷰티정보

보나수아의 이너뷰티 레코드로 콜라겐, 제대로 알고 드세요 !

게시판 상세
제목 어류 콜라겐 가수 분해물이 인간 피부 섬유 아세포 배양의 유형 I 콜라겐 mRNA 수준에 미치는 영향
작성자 (ip:)
  • 평점 0점  
  • 작성일 2021-01-19 13:13:40
  • 추천 추천하기
  • 조회수 105
 . 2018 May; 16 (5) : 144.2018 년 4 월 26 일 온라인 게시. doi :  10.3390 / md16050144
PMCID PMC5983275
PMID : 29701725

어류 콜라겐 가수 분해물이 인간 피부 섬유 아세포 배양의 유형 I 콜라겐 mRNA 수준에 미치는 영향


1. 소개

콜라겐은 동물 유기체의 결합, 피부 및 골관절 조직에있는 주요 구조 단백질입니다 [  ]. 콜라겐 원 섬유의 특징적인 로프 구조는 콜라겐의 기본 단위의 결합으로 구성되며, 3 중 나선으로 배열되고 큰 원 섬유 스트레치를 형성하는 3 개의 하위 단위 단백질 사슬에 의해 형성되며,이 단백질은지지 조직에서 필수적인 역할을 부여합니다 [  ] .

콜라겐 합성은 피부, 뼈 및 연골과 같은 다양한 신체 구조를 유지하는 데 필수적입니다. 섬유 아세포는 다른 단백질 중에서 콜라겐 [  ] 을 포함하는 세포 외 기질 (ECM)의 합성을 담당하는 주된 역할을합니다 .

피부 모양은 콜라겐 골격에 따라 달라집니다. 예를 들어 주름 형성은 콜라겐 합성 감소와 콜라게나 아제 활성 증가와 관련이 있습니다 [  ]. 피부 섬유 아세포는 콜라겐이 피부 무결성을 유지하는 데 중요한 역할을하기 때문에 일반적으로 다른 조직보다 더 높은 콜라겐 합성 속도를 나타냅니다 [  ]. 인간의 주름 발생을 예방하거나 지연시키기위한 몇 가지 접근법은 화장품을 사용하거나 피부의 콜라겐 분자를 최적으로 유지하는 데 도움이되는 영양 보충제를 섭취하는 것입니다.

이러한 제품 중 일부는 활성 성분으로 콜라겐 또는 가수 분해 콜라겐 [  ]을 포함합니다. 화장품 용 콜라겐의 전통적인 공급원은 돼지와 소의 가죽과 가죽입니다 [  ]. 그러나 오늘날에는 해양 기원의 콜라겐이 선호됩니다. 왜냐하면 그것은 동물 종이 없어 종교적 문제를 일으키고 광우병과 잠재적으로 연관 될 수있는 소 하위 제품의 단백질 사용과 관련된 잠재적 위험을 유발하기 때문입니다 [  ,  ,  ].

게다가 지속 가능한 사회 경제적 및 환경 적 원칙은 천연 자원의 완전한 사용을 촉진합니다. 이는 또한 항상 완전히 사용되지는 않는 귀중한 원자재의 중요한 원천이 될 수있는 어업에도 적용됩니다. 사용하지 않는 스킨과 같은 이러한 원료는 콜라겐, 젤라틴 및 콜라겐 가수 분해물 [  ] 과 같은 다양한 제품을 얻는 데 적합합니다 .

주요 상업 종 중 하나는 Prionace glauca (푸른 상어)로, 2015 년 비고 (스페인 북서부)에 위치한 유럽에서 가장 큰 어항에 상륙 한 여섯 번째로 중요한 냉동 어종입니다. 이 종의 상당량은 일반적으로 육지에서 처리되며 상당한 양의 가죽을 생산합니다 (연간 600 톤, 저자 소유 데이터). Vigo 물고기 경매에서 거래 된 신선 및 냉동 청상어의 양은 2015 년에 최대 5568 톤을 차지했습니다 [  ]. 이 종의 피부는 특히 성숙한 암컷의 경우 매우 두껍고 [  ] 전체 물고기 무게의 11.6 %에서 18 % 사이를 차지하므로 (공개 된 데이터가 아님) 피부는 하위 제품의 가치 평가를위한 주요 목표 중 하나가됩니다. 이 종에서.

Prionace glauca 의 피부 하위 제품은 콜라겐과 젤라틴을 얻기 위해 사용되어 필름 [  ]과 항산화 능력 [  ]을 가진 펩티드 를 생성 합니다. 우리는 이전에 Prionace glauca 와 Scyliorhinus canicula , Xiphias gladius , Thunnus albacares 와 같은 다른 어종 에서 콜라겐과 콜라겐 가수 분해물 (CH)의 생산을보고했습니다 얻은 가수 분해물 [  ] 에서 항산화 특성을 테스트 한 결과, Prionace glauca 에서도 유사한 항산화 특성이 발견되었습니다.다른 상어에 비해. 항산화, 항 고혈압 또는 상처 치유 특성을 가진 콜라겐 펩타이드는 또한 스케이트, 가자미 [  ], 알래스카 명태, 오징어 [  ] 또는 나일 틸라피아 [  ] 와 같은 다양한 어종에서 얻었습니다 .

현재 연구에서 인간 섬유 아세포는 청상어 ( Prionace glauca ) 피부 콜라겐 가수 분해물 (PGLA-CH)과 상업용 콜라겐 가수 분해물 (C-CH)의 양과 분자량이 서로 다른 존재 하에서 배양되었습니다 . 콜라겐 유형 I 합성에 대한 이러한 치료의 효과.

2. 결과

2.1. 콜라겐 가수 분해물

PGLA 펩신 가용성 콜라겐 (PSC)을 사용하여 CH를 얻었다. 이전에보고 된 바와 같이, PGLA PSC는 116 kDa 미만의 분자량 밴드를 갖는 특징적인 유형 I Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS-PAGE) 패턴을 제시했습니다 [  ]. 그러나 이러한 저 분자량 펩타이드 (<20 kDa)는 SDS-PAGE 겔에서 볼 수 없지만 PSC는 해당 산성 가용성 콜라겐보다 평균 저 분자량을 나타냅니다 [  ].

전술 한 바와 같이 PGLA PSC는 또한, 알 칼라로 소화시킨  ], PGLA-CH를 획득 16.52 ± 3.74 %의 최종 가수 분해 정도를 달성. 이 가수 분해물을 동결 건조하고 물에 현탁시킨 다음 한외 여과하여 두 가지 분획을 얻었다 : 3000 Da 차단막을 통과 한 PGLA-CH의 일부를 나타내는 투과 물 분획 (PF); 및 막을 뚫지 않은 잔류 분획 (RF).

그림 1두 PGLA-CH 분획의 크로마토 그래피 프로필과 각 경우에 얻은 평균 분자량을 보여줍니다. 이 그림에서 볼 수 있듯이 RF는 PF보다 평균 분자량이 높은 피크를 보였고 RF에서 가장 높은 피크는 1.45 kDa 분자량에 해당하고 PF에서 가장 높은 피크는 약 0.57 kDa입니다.


그림, 일러스트레이션 등이 들어있는 외부 파일입니다. 개체 이름은 marinedrugs-16-00144-g001.jpg입니다.

A ) 알 칼라 제 가수 분해 청상어 ( Prionace glauca ) 피부 콜라겐 가수 분해물 (PGLA-CH) 잔류 분획 (RF)의 크기 배제 크로마토 그래피 프로파일 B ) 알 칼라 제 가수 분해 된 PGLA-CH 투과 물 분획 (PF)의 크기 배제 크로마토 그래피 프로파일.

유사하게, C-CH도 분류되었고 그림 2 C-CH 분획의 크로마토 그래피 프로파일을 보여 주며, PGLA-CH에 대해 나타난 바와 같이 PF는 RF보다 낮은 평균 분자량을 보였지만,이 경우 두 평균 분자량 모두 PGLA-에 대해 얻은 것보다 높았습니다. CH RF 및 PF.


그림, 일러스트레이션 등이 들어있는 외부 파일입니다. 개체 이름은 marinedrugs-16-00144-g002.jpg입니다.

A ) 상업적인 콜라겐 가수 분해물 (C-CH) RF의 크기 배제 크로마토 그래피 프로파일; B ) C-CH PF의 크기 배제 크로마토 그래피 프로파일.

1 번 테이블 4 개의 가수 분해 분획에 대한 아미노산 조성을 보여 주며, 프로파일이 매우 유사하고 글리신, 알라닌, 프롤린, 히드 록시 프롤린과 같은 주요 아미노산에서 약간의 차이 만 발견되었음을 확인할 수 있습니다.

1 번 테이블

PGLA-CH RF, PGLA-CH PF, C-CH RF 및 C-CH PF의 아미노산 조성 (잔기 / 100 잔기). 값은 세 가지 결정 ± 표준 편차의 수단입니다.

아미노산PGLA-CH RFPGLA-CH PFC-CH RFC-CH PF
아스파르트 산4.39 ± 0.023.43 ± 0.034.98 ± 0.013.37 ± 0.05
트레오닌2.19 ± 0.022.31 ± 0.022.18 ± 0.012.44 ± 0.03
세린4.09 ± 0.154.35 ± 0.133.57 ± 0.103.71 ± 0.01
글루탐산7.18 ± 0.026.92 ± 0.047.61 ± 0.055.99 ± 0.19
글리신33.97 ± 0.0634.20 ± 0.1632.56 ± 0.0238.90 ± 0.21
알라닌11.40 ± 0.1013.55 ± 0.1011.57 ± 0.0111.46 ± 0.01
시스테인0.20 ± 0.030.29 ± 0.040.23 ± 0.070.28 ± 0.01
발린1.81 ± 0.052.48 ± 0.052.53 ± 0.033.15 ± 0.02
메티오닌1.38 ± 0.011.87 ± 0.110.86 ± 0.001.13 ± 0.03
이소류신1.92 ± 0.021.49 ± 0.031.11 ± 0.011.58 ± 0.02
류신2.07 ± 0.042.63 ± 0.013.21 ± 0.014.44 ± 0.01
티로신0.00 ± 0.000.09 ± 0.120.65 ± 0.011.22 ± 0.13
페닐알라닌1.50 ± 0.011.49 ± 0.031.73 ± 0.022.79 ± 0.07
히스티딘0.49 ± 0.000.57 ± 0.010.42 ± 0.010.53 ± 0.02
라이신2.61 ± 0.022.50 ± 0.063.05 ± 0.012.76 ± 0.04
아르기닌4.95 ± 0.015.31 ± 0.014.65 ± 0.044.73 ± 0.22
하이드 록시 프롤린8.29 ± 0.046.07 ± 0.118.62 ± 0.075.07 ± 0.40
프롤린11.56 ± 0.0210.46 ± 0.0210.49 ± 0.066.45 ± 0.09

Gly 함량은 C-CH PF에서 더 높았고 Hydroxyproline (HyPro)은 PF에 비해 두 RF 분획에서 더 높았습니다.

2.2. 섬유 아세포 배양의 mRNA 콜라겐 합성에 대한 CH의 영향

첨가 된 PGLA-CH PF 또는 RF의 양은 이들 추출물의 상이한 농도 (각각 p = 0.0959 및 p = 0.4093) 로 24 시간 동안 처리 된 섬유 아세포의 콜라겐 발현을 유의하게 증가시키지 않았다 더욱이, 가장 낮은 농도의 PGLA-CH PF (50 μg / mL)를 사용한 처리는 대조군 아래에서 과발현 또는 발현이없는 상대적 정량 값 (RQ 값)을 보여 주었다; PGLA-CH RF의 경우, 최고 농도 처리 (500μg / mL)는 유의미하지는 않지만 가장 높은 RQ 값을 나타 냈습니다. 어떤 농도 (50, 100, 500 μg / mL) 로 처리 24 시간 ( p = 0.0735) 후 PF 또는 RF로 섬유 아세포를 처리 한 후 RQ 값 사이에 유의 한 차이가 없습니다 p= 0.3925), 또는 두 요인의 상호 작용 ( p = 0.3534) (그림 3).


그림, 일러스트레이션 등이 들어있는 외부 파일입니다. 개체 이름은 marinedrugs-16-00144-g003.jpg입니다.

섬유 아세포에 추가 된 PGLA-CH (μg / mL)의 양이 증가함에 따라 콜라겐 I 형 mRNA에 대한 상대 정량화 (RQ) 값. RQ 값은 다섯 가지 결정의 평균이고 오차 막대는 표준 편차입니다. 파란색 막대 : 50 μg / mL CH, 분홍색 막대 : 100 μg / mL CH, 노란색 막대 : 500 μg / mL. A ) PGLA-CH RF로 24 시간 처리 한 후 얻은 RQ 값. B ) PGLA-CH PF로 24 시간 처리 한 후 얻은 RQ 값. C ) PGLA-CH RF로 48 시간 처리 한 후 얻은 RQ 값. D ) PGLA-CH PF로 48 시간 처리 한 후 얻은 RQ 값.

48 시간 동안 PGLA-CH 분획으로 처리 한 세포의 경우 PGLA-CH RF 또는 PGLA-CH PF로 처리 한 세포의 RQ 값 사이에 유의 한 효과가 발견되었습니다 ( p = 0.0017). PGLA-CH RF는 PF보다 높은 RQ 값을 생성했습니다.그림 3그러나,이 경우, RQ가 농도에 관한 값 (50, 100, 500 ㎍ / ㎖) ( P = 0.1879), 또는 두 요소의 상호 작용 ( P = 0.0813)에 유의하지 않았다 (그림 3).

C-CH는 또한 섬유 아세포에 의한 mRNA 콜라겐 합성에 미치는 영향을 테스트하는 데 사용되었습니다 (그림 4). 농도는 24 시간 동안 C-CH PF ( p = 0.1106)로 처리 한 후 RQ 값에 유의 한 영향을 미치지 않았으며 , C-CH RF의 경우 유의 한 차이가 관찰되었습니다 ( p = 0.0181),이 경우, C-CH RF (50 μg / mL)의 낮은 농도에서 더 높은 RQ 값을 생성하는 용량-반응 효과가 관찰되었습니다. 또한 이전에 PGLA-CH 분획에서 발견 된 바와 같이 C-CH PF와 RF RQ 값 ( p = 0.0028) 간에 유의 한 차이가 발견되었으며 농도와 상호 작용이 유의미한 결과를 얻지 못했습니다 p = 0.5918, p = 0.1245).


그림, 일러스트레이션 등이 들어있는 외부 파일입니다. 개체 이름은 marinedrugs-16-00144-g004.jpg입니다.

섬유 아세포에 추가 된 C-CH (μg / mL)의 양이 증가하는 콜라겐 유형 I mRNA에 대한 RQ 값. RQ 값은 다섯 가지 결정의 평균이고 오차 막대는 표준 편차입니다. 파란색 막대 : 50 μg / mL CH, 분홍색 막대 : 100 μg / mL CH, 노란색 막대 : 500 μg / mL. A ) C-CH RF로 24 시간 처리 한 후 얻은 RQ 값. B ) C-CH PF로 24 시간 처리 한 후 얻은 RQ 값.

3. 토론

이전의 일부 연구에서는 콜라겐 가수 분해물이 피부 나 연골과 같은 다른 조직의 콜라겐 회전율 / 균형에 영향을 미칠 수 있으며 콜라겐 가수 분해물을 바르거나 섭취하는 것이 피부 나 연골의 노화를 예방하는 데 도움이 될 수 있음을 입증하는 목적이있었습니다 [  ].

상업적 소 콜라겐 가수 분해물에 위치한 펩타이드의 분자량 다양한 의문 콜라겐 합성 개선 콜라겐 가수 분해물을 사용하는 과학적 근거 호출 다른 콜라겐 소스 무결성 및 효소가 이러한 가수 분해물을 생산하는데 사용될 수 있음을 나타낸다  ].

이 작업에서는 Prionace glauca 의 피부에서 추출한 PSC를 사용했습니다.HPLC에 의해 특성화 된 알 칼라 제 가수 분해물을 생산하였고,이 가수 분해물을 시판되는 것과 비교 한 결과 두 가수 분해물의 평균 분자량이 다른 것으로 밝혀졌습니다. 시판되는 가수 분해물은 콜라겐이 생성 된 종을 명시하지 않으며이 가수 분해물이 어떻게 생성되었는지를 나타내지 않습니다. 또한, 비상업적 가수 분해물에는 마그네슘이 포함되어 있습니다 (C-CH에는 31.6mg의 마그네슘 염과 600mg의 가수 분해 된 콜라겐이 존재했습니다). PGLA-CH와의 주요 차이점은 C-CH PF의 평균 고 분자량과 약간 더 낮은 Pro 함량이었습니다. 우리는 PGLA CH를 분석 할 때 분자량이 콜라겐 합성에 영향을 미치는 것을 관찰했습니다. RF는 일반적으로 PF보다 높은 RQ 값을 보였으며 이는 특히 48 시간 후에 두드러집니다. C-CH의 경우

따라서 우리는 CH 처리 후 RQ 값 차이를 설명하는 중요한 요소 중 하나가 세포 처리에 사용되는 펩타이드의 평균 분자량임을 시사합니다. 우리는 또한 C-CH의 경우 일부 성분의 존재가 mRNA 합성을 방해 할 수 있음을 관찰했습니다. 마그네슘 섭취는 콜라겐 합성의 조절 및 골밀도 향상과 관련 이 있지만  ],이 경우 C-CH에 존재하는 양은 섬유 아세포를 직접 치료하기에는 너무 높을 수 있습니다. 100μg / mL 처리, 콜라겐 I 형 mRNA 합성 방지 (각각 12.5μg 및 2.50μg의 Mg).

일부 저자는 일부 아미노산의 존재 또는 함량이 섬유 아세포 활성 (이동, 화학 주성 및 증식)을 증가시킬 수 있다고 제안했으며, 특히 섬유 아세포에 가까운 Pro-HyPro 및 HyPro-Gly의 존재가 이에 대한 원인으로 제안되었습니다. 섬유 아세포 활성 [  ]. 이러한 발견은 특히 PF 분획에 비해 PGLA-CH RF 및 C-CH RF의 더 높은 HyPro 함량으로, 48 시간 처리 후 더 높은 콜라겐 유형 I mRNA를 보여주는 우리의 결과와 일치합니다.

4. 재료 및 방법

4.1. 원료

청상어 Prionace glauca (PGLA)의 냉동 껍질 은 수산 산업 Lumar SL (A Pobra do Caramiñal, Spain)에서 제공했으며 사용할 때까지 -20 ° C에서 보관했습니다. 피부에 부착 된 근육의 잔류 물을 제거한 다음, 피부를 작은 조각 (0.5 x 0.5 cm 2 ) 으로 자르고 완전히 혼합하고 필요할 때까지 -20 ° C에서 냉동 보관했습니다.

어종은 이전에 설명한 방법을 사용하여 피부에 부착 된 근육 부분에서 DNA 분석을 통해 확인되었습니다 [  ].

4.2. 피부에서 펩신 용해성 콜라겐 (PSC) 추출

PGLA 피부에서 콜라겐 추출은 [  ]에 설명 된대로 4 ° C에서 수행되었습니다 . 200g의 피부를 3L의 0.1N NaOH와 혼합하고 24 시간 동안 교반하고 알칼리 용액을 3 번 변경 한 다음 알칼리 용액 제거하고 피부를 중성 pH까지 차가운 증류수로 세척 하였다. 콜라겐 추출은 0.1 % (w / v) 펩신 (0.5 U / mg; Acros Organics, Janssen Pharmaceutical, Geel, Belgium)을 함유하는 0.5M 아세트산으로 24 시간 동안 (1:40 피부 중량 / 산 부피) 수행되었습니다. 그 다음 현탁액을 6000 × g 에서 원심 분리 하였다.4 ° C에서 20 분 동안 잔류 물을 버리고 상등액을 NaCl로 최종 농도 2.0M로 염석 제거했습니다. 침전 된 콜라겐을 0.5M 아세트산에 녹인 다음 냉 증류수로 3 일간 투석합니다. 12,000 Da 컷오프 투석막 및 연속 교반. 투석 된 PSC는 동결 건조되었고 가수 분해에 사용될 때까지 -20 ° C에서 보관되었다.

4.3. 콜라겐의 효소 가수 분해 및 PSC 가수 분해물의 특성화

효소 가수 분해는 앞서 [  ] 에서 설명한대로 수행되었습니다 비교를 위해 상업적인 콜라겐 가수 분해물 (Collagen with Magnesium, Ana Maria Lajusticia, Barcelona, Spain)을 사용했습니다. 제품 라벨은 600mg의 가수 분해 된 콜라겐과 31.6mg의 마그네슘 염이 알약에 존재 함을 나타냅니다. 종 또는 원산지 라벨에는 표시가 없습니다.

4.3.1. 가수 분해물의 분별

동결-건조 된 가수 분해물 (4g)을 증류수 (1 %)에 용해시키고 분자량 (MW)이 다음과 같이 차단 된 한외 여과 원심 분리 장치 (Amicon Ultra-15 Unit, Merck Millipore, Darmstadt, Germany)를 사용하여 두 단계로 한외 여과합니다. 10 및 3 kDa. 이 과정은 두 개의 분획을 얻었습니다 : 10 ~ 3 kDa MW 범위의 펩타이드를 갖는 잔류 분획 (RF)과 3 kDa MW 미만의 펩타이드를 갖는 투과 분획 (PF). 두 분획 모두 동결 건조하고 사용할 때까지 -20 ° C에서 보관했습니다.

4.3.2. 크기 배제 크로마토 그래피

가수 분해물의 MW 분포는 Superdex Peptide 10/300 GL 컬럼이 장착 된 Agilent 1260 Infinity 시스템 (Agilent Technologies, Santa Clara, CA, USA)에서 겔 여과 크로마토 그래피에 의해 추정되었으며, 용리액으로 30 % 아세토 니트릴에 0.1 % TFA가 있습니다. .

동결 건조 된 RF 및 PF를 용리액 (30 % 아세토 니트릴 중 0.1 % TFA) (0.5g / mL)에 용해시키고 0.22μm 필터를 통해 여과했습니다. 20 μL의 샘플을 주입하고 0.4 mL / min에서 용출하고 220 nm에서 모니터링했습니다. 컬럼을 표준 단백질 (Sigma-Aldrich, Saint Louis, MS, USA) : 사이토 크롬 C (12,400 Da), 아프로 티닌 (6500 Da), 안지오텐신 II (1046 Da), 류신-엔케팔린 (555 Da), Val- Tyr-Val (379 Da) 및 Gly-Tyr (238 Da).

4.4. PSC 가수 분해물을 사용한 세포 배양 및 처리

성체 인간 진피 섬유 아세포 ( 스페인 데 리오, 이노 프로트로부터의 P10858 HDFa)를 사용 하였다. 세포를 95 % 습도 및 95 % 습도 및 1 % 페니실린 / 스트렙토 마이신 용액, 기초 배지, 소 태아 혈청 2 %, 섬유 아세포 성장 보충제 1 %를 함유하는 ScienCell (미국 캘리포니아 주 칼스 배드)의 섬유 아세포 배지 (FM)와 함께 배양했습니다. 5 % CO 2 , 온도 조절 인큐베이터의 플라스크에서. 세포 (50,000)를 24 웰 플레이트의 각 웰에 옮기고 또한 37 ° C, 5 % CO에서 24 시간 동안 배양 하였다 (2)그런 다음 FM을 웰에서 제거하고 아래 설명 된대로 다른 CH 분획을 포함하는 FM 배지로 대체했습니다. 각 농도 및 CH 유형으로 처리 된 섬유 아세포의 5 개 복제 (웰)를 24 시간 및 48 시간 동안 배양했습니다. 이 기간이 끝나면 각 웰의 총 RNA를 Cells-to-CT 1-Step Taqman Kit (Ambion, Waltham, USA)로 추출했습니다. 간단히 말해서, FM 함유 CH 배지를 제거하고 400 μL의 차가운 인산염 완충 식염수 (PBS)를 각 웰 세척에 사용했습니다. 그 후, 키트와 함께 제공된 100 μL의 용해 완충액을 각 웰에 첨가하고 세포와 완전히 혼합하고 혼합물을 실온에서 5 분 동안 방치했습니다. 그런 다음 각 웰에 10 μL의 정지 용액을 첨가하고 혼합 한 다음 2 분 동안 더 배양했습니다. 그 시간이 지나면 각 웰의 액체를 수집하여 1.5 mL Eppendorf 튜브로 옮겼습니다. 마지막으로, 각 웰을 추가로 100 μL의 차가운 PBS로 세척하고 생성 된 액체를 수집하여 이전에 얻은 액체와 혼합했습니다.

동결 건조 된 CH PF 및 RF를 FM (1 mg / mL)에 용해시키고 PVDF 0.22 μm를 통해 여과했습니다. 이 스톡에서 필요에 따라 FM을 사용하여 연속 희석액을 준비했습니다 (표 2). 500 µl의 최종 부피를 각 웰에 첨가하여 섬유 아세포를 처리했습니다.

표 2

섬유 아세포 배지 (FM)로 제조 된 CH PF 및 CH RF의 농도는 섬유 아세포 세포 치료에 사용됩니다.

집중
치료 성분500 µg / mL100 µg / mL50 µg / mL제어
CH PF 및 RF250µL50µL25µL-
FM250µL450µL475µL500µL

추출 된 총 RNA는 Nanodrop (260nm)으로 측정되었으며 RNA 농도는 35ng / μL로 조정되었습니다. 이러한 RNA 추출물은 RT-PCR로 분석 할 때까지 -20 ° C에서 유지되었습니다.

4.5. RT-PCR 분석

참조 유전자 GAPDH를 사용하여 상대 정량 (RQ) 유형 I 콜라겐 mRNA (COL I)로 정량화하기 위해 실시간 PCR을 사용했습니다.

Real time PCR 분석은 7500 Fast Real-Time PCR System 장비 (Applied Biosystems, Waltham, MA, USA)에서 다음과 같은 프라이머와 프로브를 사용하여 수행되었습니다. 표 3 ,  ] 및 Express One-Step Superscript ® qRT-PCR 키트 (Invitrogen, Waltham, MA, USA).

표 3

콜라겐 유형 I의 RQ에 사용되는 프라이머 및 프로브의 순서.

프라이머 / 프로브시퀀스 5 '→ 3'
GAPDH- 포워드GGAAGCTCACTGGCATGGC
GAPDH- 역방향TAGACGGCAGGTCAGGTCCA
GAPDH 프로브VIC-CCCCACTGCCAACGTGTCAGTG-MGB
COL_I- 포워드ATGCCTGGTGAACGTGGT
COL_I- 역방향AGGAGAGCCATCAGCACCT
COL_I- 프로브6-FAM-ACCAGCATCACCTCTGTC-MGB

RNA (70ng)는 콜라겐 I 형 mRNA의 RQ에 사용되었습니다. 역전사는 15 분 동안 50 ° C에서 수행되었습니다. 그런 다음 95 ° C에서 2 분, 95 ° C에서 15 초 동안 40 사이클 후 60 ° C에서 1 분을 증폭 조건으로 사용했습니다.

4.6. 통계 분석

각 실험 처리는 각 처리 및 대조군에 대해 배양 웰당 5 개의 복제를 사용하여 수행되었습니다. 처리 된 섬유 아세포에 대한 RQ 데이터는 처리되지 않은 섬유 아세포 대조군으로 얻었다. RQ 결과는 일원 및 이원 분산 분석 (ANOVA)과 Mac OS X 용 통계 소프트웨어 GraphPad Prism 버전 7.00, GraphPad Software, La Jolla, CA, USA, www.graphpad를 사용한 Tukey의 다중 비교 테스트를 사용하여 평가되었습니다. .com . 유의성은 p <0.05 로 설정되었습니다 .

5. 결론

우리의 연구는 콜라겐 가수 분해물의 영양 학적 효과를 지원하기위한 과학적 연구의 중요성을 보여줍니다. 우리는 또한 펩티드의 아미노산 조성이 이전에 제안 된 바와 같이 섬유 아세포에 의한 콜라겐 유형 I mRNA의 자극에 중요 할 수있을뿐만 아니라 펩티드의 분자량도 mRNA 생산과 관련이 있음을 발견했습니다. 섬유 아세포, 시험관 내 및 생체 내에서 콜라겐 유형 I mRNA를 자극하기 위해 특정 분자량 및 아미노산 조성이 모두 필요하다는 것을 확인하기 위해 추가 연구가 필요합니다.

감사의 말

기술 지원에 대해 Marta Pérez Testa에게 감사드립니다. 이 작업은 EU 대서양 지역 프로그램 프로젝트 번호 2011-1 / 164의 지원을받는 MARMED 프로젝트의 자금으로 지원되었습니다. 이 작업에 사용 된 피부 샘플에 대해 Lumar SL에게 감사드립니다.

저자 기여

CGS 및 RIP-M. 실험을 구상하고 설계했습니다. AS, MB 및 BC가 실험을 수행했습니다. AS, MB 및 CGS는 데이터를 분석했습니다. CGS가 논문을 썼습니다.

이해 상충

저자는 이해 상충을 선언하지 않습니다.

참고 문헌

1. 어깨 MD, Raines RT 콜라겐 구조 및 안정성. Annu. Biochem. 2009; 78 : 929–958. 도이 : 10.1146 / annurev.biochem.77.032207.120833. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
2. Benjakul S., Nalinanon S., Shahidi F. Fish Collagen. 에서 : Simpson BK, Nollet LML, Toldra F., Benjakul S., Paliyath G., Hui YH, 편집자. 식품 생화학 및 식품 가공. John Wiley & Sons; 미국 뉴저지 주 호보 켄 : 2012. pp. 365–387.  ]
3. Lindner D., Zietsch C., Becher PM, Schulze K., Schultheiss HP, Tschöpe C., Westermann D. 기원이 다른 인간 섬유 아세포에서 매트릭스 금속 단백 분해 효소의 차별적 발현. Biochem. 입술. Int. 2012; 2012 년 doi : 10.1155 / 2012 / 875742. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
4. Tanaka M., Koyama Y., Nomura Y. 콜라겐 펩타이드 섭취가 UV-B로 인한 피부 손상에 미치는 영향. Biosci. Bioechnol. Biochem. 2009; 73 : 930 ~ 932. 도이 : 10.1271 / bbb.80649. PubMed ] [ CrossRef ]  ]
5. Alves A., Marques A., Martins E., Silva T., Reis R. 해양 물고기 피부 콜라겐의 화장품 잠재력. 화장품. 2017; 4 : 3. 도이 : 10.3390 / cosmetics4040039. CrossRef ]  ]
6. Gomez-Guillen MC, Gimenez B., Lopez-Caballero ME, Montero MP 대체 공급원의 콜라겐과 젤라틴의 기능 및 생리 활성 특성 : 리뷰. 식품 Hydrocoll. 2011; 25 : 1813 ~ 1827. 도이 : 10.1016 / j.foodhyd.2011.02.007. CrossRef ]  ]
7. 육류 및 육류 제품의 Nakyinsige K., Man YBC, Sazili AQ Halal 진위 문제. 고기 과학. 2012; 91 : 207–214. 도이 : 10.1016 / j.meatsci.2012.02.015. PubMed ] [ CrossRef ]  ]
8. Lupi O. Doenças priônicas : Avaliaçao dos riscos envolvidos na utilizaçao de produtos de origem bovina. 안. 브래지어. Dermatol. 2003; 78 : 7 ~ 16. 도이 : 10.1590 / S0365-05962003000100002. CrossRef ]  ]
9. Scott MR, Will R., Ironside J., Nguyen H.-OB, Tremblay P., DeArmond SJ, Prusiner SB 인간에게 소 해면상 뇌병증 프리온의 전파에 대한 강력한 이식 유전 학적 증거. Proc. Natl. Acad. Sci. 미국. 1999; 96 : 15137–15142. 도이 : 10.1073 / pnas.96.26.15137. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
10. Blanco M., Sotelo CG, Chapela MJ, Pérez-Martín RI 어업 자원의 지속 가능하고 효율적인 사용을 향하여 : 현재와 미래의 동향. Trends Food Sci Tech. 2007; 18 : 29 ~ 36 . 도이 : 10.1016 / j.tifs.2006.07.015. CrossRef ]  ]
11. Vigo AP De Puerto de Vigo. 연례 보고서 2016. Puerto de Vigo; 스페인 갈리시아 : 2016.  ]
12. Pratt HL, Carrier JC 간호사 상어 Ginglymostoma cirratum에 대한 사례 연구와 함께 elasmobranch 생식 행동에 대한 검토. 환경. Biol. 물고기. 2001; 60 : 157–188. 도이 : 10.1023 / A : 1007656126281. CrossRef ]  ]
13. Limpisophon K., Tanaka M., Weng WY, Abe S., Osako K. 잘 활용되지 않은 청상어 ( Prionace glauca ) 피부 에서 제조 된 젤라틴 필름의 특성 분석 식품 Hydrocoll. 2009; 23 : 1993–2000. 도이 : 10.1016 / j.foodhyd.2009.03.014. CrossRef ]  ]
14. Weng W., Tang L., Wang B., Chen J., Su W., Osako K., Tanaka M. 청상어 ( Prionace glauca ) 피부 젤라틴 가수 분해물 에서 분리 된 분획의 항산화 특성 J. Funct. 음식. 2014; 11 : 342–351. 도이 : 10.1016 / j.jff.2014.10.021. CrossRef ]  ]
15. Blanco M., Vázquez JA, Pérez-Martín RI, Sotelo CG 어류 피부 콜라겐 가수 분해물 : 어류 산업 부산물의 가치를 평가할 수있는 기회. Mar. 마약. 2017; 15 : 131. 도이 : 10.3390 / md15050131. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
16. Cheung RCF, Ng TB, Wong JH 해양 펩타이드 : 생물 활성 및 응용. 3 월 마약. 2015; 13 : 4006–4043. 도이 : 10.3390 / md13074006. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
17. Hu Z., Yang P., Zhou C., Li S., Hong P. 나일 틸라피아 ( Oreochromis niloticus ) 의 피부에서 추출한 해양 콜라겐 펩티드 : 특성화 및 상처 치유 평가. Mar. 마약. 2017; 15 : 102. 도이 : 10.3390 / md15040102. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
18. Oliveira de Sousa RA 석사 논문. Escola Superior de Turismo e Tecnologia do Mar, Intituto Politecnico de Leiria; Leiria, Portugal : 2017. 화장품 및 생물 의학 분야에서 잠재적 인 응용 가능성이있는 콜라겐 추출에 의한 대구 (Gadus morhua) 부산물의 가치 평가.  ]
19. Koizumi S., Inoue N., Shimizu M., Kwon CJ, Kim HY, Park KS 생선 비늘 유래 콜라겐 펩타이드의식이 보충제가 피부 매개 변수 및 상태에 미치는 영향 : 무작위, 위약 대조, 이중 맹검 연구 . Int. J. Pept. 입술. 거기. 2017 : 1–6. 도이 : 10.1007 / s10989-017-9626-0. CrossRef ]  ]
20. Schadow S., Siebert HC, Lochnit G., Kordelle J., Rickert M., Steinmeyer J. 소 콜라겐 가수 분해물에 의해 조절 된 인간 골관절염 관절 연골의 콜라겐 대사. PLoS ONE. 2013; 8 : e53955. 도이 : 10.1371 / journal.pone.0053955. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
21. Noma T., Takasugi S., Shioyama M., Yamaji T., Itou H., Suzuki Y., Sakuraba K., Sawaki K.식이 젤라틴 가수 분해물이 마그네슘이 부족한 쥐의 골밀도에 미치는 영향. BMC 근골격. Disord. 2017; 18 : 1 ~ 6. 도이 : 10.1186 / s12891-017-1745-4. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
22. Postlethwaite AE, Seyer JM, Kang AH 인간 섬유 아세포의 유형 I, II 및 III 콜라겐과 콜라겐 유래 펩타이드에 대한 Chemotactic 인력. Proc. Natl. Acad. Sci. 미국. 1978; 75 : 871–875. 도이 : 10.1073 / pnas.75.2.871. PMC 무료 기사 ] [ PubMed ] [ CrossRef ]  ]
23. Blanco M., Pérez-Martín RI, Sotelo CG 법 의학적 정보를 제공하는 nucleotide sequencing (FINS)에 의한 해산물 제품의 상어 종 식별 J. Agric. Food Chem. 2008; 56 : 9868–9874. 도이 : 10.1021 / jf8015128. PubMed ] [ CrossRef ]  ]
24. Medhurst AD, Harrison DC, Read SJ, Campbell CA, Robbins MJ, Pangalos MN CNS 조직 및 질병 모델에서 유전자 발현의 반 정량 분석을위한 TaqMan RT-PCR 분석의 사용. J. Neurosci. 행동 양식. 2000; 98 : 9 ~ 20. doi : 10.1016 / S0165-0270 (00) 00178-3. PubMed ] [ CrossRef ]  ]
25. Marlovits S., Hombauer M., Truppe M., Vècsei V., Schlegel W. 인간 연골 세포의 단층 배양 동안 type-I 및 type-II 콜라겐 발현 비율의 변화. J. Bone Jt. Surg. 2004; 86 : 286–295. 도이 : 10.1302 / 0301-620X.86B2.14918. PubMed ] [ CrossRef ]  ]



첨부파일 20210119_131302.png
비밀번호 삭제하려면 비밀번호를 입력하세요.
댓글 수정

비밀번호 :

/ byte

비밀번호 : 확인 취소